Abstract |
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.
|
Authors | M Fry, L A Loeb |
Journal | The Journal of biological chemistry
(J Biol Chem)
Vol. 274
Issue 18
Pg. 12797-802
(Apr 30 1999)
ISSN: 0021-9258 [Print] United States |
PMID | 10212265
(Publication Type: Journal Article, Research Support, Non-U.S. Gov't, Research Support, U.S. Gov't, Non-P.H.S., Research Support, U.S. Gov't, P.H.S.)
|
Chemical References |
|
Topics |
- Base Sequence
- DNA
(chemistry)
- DNA Helicases
(chemistry, metabolism)
- Fragile X Syndrome
(genetics)
- Humans
- Nucleic Acid Conformation
- Trinucleotide Repeats
- Werner Syndrome
(enzymology)
|